Review

cropseq guide puro vector (Addgene inc)

Addgene inc is a verified supplier

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Addgene inc cropseq guide puro vector
Cropseq Guide Puro Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 124 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cropseq+guide+puro+vector/CROPseq-Guide-Puro+(Plasmid+%2386708)/pmc12680425-86-7-9
Average 96 stars, based on 124 article reviews

cropseq guide puro vector - by Bioz Stars, 2026-10

96/100 stars

Images

Clone Assay:

Article Title: Alzheimer’s disease protective allele of Clusterin modulates neuronal excitability through lipid-droplet-mediated neuron-glia communication
Article Snippet: Online tool Benchling ( https://www.benchling.com/ ) was used to design CRISPR guide RNA (gRNA), and the gRNAs with highest off-target score (specificity) were selected ( Table S15 ). .. The gRNAs were cloned into CROPseq-Guide-Puro vector (#86708, Addgene) . .. The gRNA plasmid DNAs, together with the plasmid DNAs of pSpCas9(BB)-2A-Puro (#62988, Addgene) and pSUPERIOR.puro-shp53 (#38035, Addgene) (included to transiently inhibit p53 and increase editing efficiency ) were transiently transfected into iPSCs.

Article Title: PICALM Alzheimer’s risk allele causes aberrant lipid droplets in microglia
Article Snippet: .. The gRNA sequences were designed using Benchling ( https://benchling.com ; Supplementary Table ), and cloned into the CROPseq-Guide-Puro vector (Addgene, 86708) for co-expression with CRISPRoff v.2.1 (Addgene, 167981) as described previously . ..

Article Title: Alzheimer’s disease protective allele of Clusterin modulates neuronal excitability through lipid-droplet-mediated neuron-glia communication
Article Snippet: The online tool Benchling ( www.benchling.com ) was used to design CRISPR guide RNA (gRNA), and the gRNAs with highest off-target score (specificity) were selected (Table S15). .. The gRNAs were cloned into CROPseq-Guide-Puro vector (Addgene, #86,708) [ ]. .. The gRNA plasmid DNAs, together with the plasmid DNAs of pSpCas9(BB)− 2A-Puro (Addgene, #62,988) [ ] and pSUPERIOR.puro-shp53 (Addgene, #38,035) (included to transiently inhibit p53 and increase editing efficiency [ ]) were transiently transfected into iPSCs.

Article Title: PICALM Alzheimer's risk allele causes aberrant lipid droplets in microglia.
Article Snippet: .. The gRNA sequences were designed using Benchling (https://benchling.com; Supplementary Table 19), and cloned into the CROPseq-Guide-Puro vector (Addgene, 86708) for co-expression with CRISPRoff v.2.1 (Addgene, 167981) as described previously77. ..

Article Title: Alzheimer’s disease risk allele of PICALM causes detrimental lipid droplets in microglia
Article Snippet: 73 | P a g e CRISPRoff epigenome editing of human iPSC CRISPRoff guide RNA (gRNA) sequences were designed using online tool (benchling.com) (Extended Data Table 16). .. The gRNAs were cloned into CROPseq-Guide-Puro vector (Addgene #86708) for co-expression with CRISPRoff-v2.1 (Addgene #167981) based on an established protocol 86. .. After 72 hr of drug selection, transfection cells were sorted using a BD FACSAria II and the sorted cells were passaged two times and then differentiated into iMG.

Article Title: In vivo single-cell CRISPR uncovers distinct TNF-α programs in clonal expansion and tumorigenesis
Article Snippet: .. The puromycin resistance cassette in the original CROPseq-Guide-Puro vector (Addgene #86708) was replaced with a mCherry sequence, amplified from pAAVS1-NDi-CRISPRi (Gen1) (Addgene #73497) and cloned in via Pfl23II and MluI restriction sites for fluorescent-assisted cell sorting. .. The 500 sgRNA sequences were ordered as oligo pool from IDT, cloned in batch via Gibson assembly or via BsmbI restriction sites for single guides as previously described .

Plasmid Preparation:

Article Title: Alzheimer’s disease protective allele of Clusterin modulates neuronal excitability through lipid-droplet-mediated neuron-glia communication
Article Snippet: The online tool Benchling ( www.benchling.com ) was used to design CRISPR guide RNA (gRNA), and the gRNAs with highest off-target score (specificity) were selected (Table S15). .. The gRNAs were cloned into CROPseq-Guide-Puro vector (Addgene, #86,708) [ ]. .. The gRNA plasmid DNAs, together with the plasmid DNAs of pSpCas9(BB)− 2A-Puro (Addgene, #62,988) [ ] and pSUPERIOR.puro-shp53 (Addgene, #38,035) (included to transiently inhibit p53 and increase editing efficiency [ ]) were transiently transfected into iPSCs.

Article Title: Systematic identification of post-transcriptional regulatory modules
Article Snippet: Briefly, a library of 205 sgRNAs (5 non-targeting sgRNAs and 200 sgRNAs targeting 100 genes, 2 sgRNAs per gene) was ordered as a pooled oligonucleotide library from Twist Bioscience with the following design: [ATCTTGTGGAAAGGACGAAACACCG]-[Protospacer Sequence]-[GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC] The library was PCR-amplified using Q5 Hot Start High-Fidelity 2X Master Mix (NEB VWR International: 102500-140) with the primers with the following sequences: 5’-ATCTTGTGGAAAGGAC-3’ and 5’-GCCTTATTTTAACTTGCTA-3’. .. To clone libraries into CROPseq-Guide-Puro vector (Addgene #86708), the starting vector was digested with BsmBI (Fisher Scientific FERER0451) following the protocol outlined in ref. . ..

Article Title: Dissecting cellular ecosystem with single-cell CRISPR screens
Article Snippet: .. To construct the sgRNA expression library, the CROPseq-Guide-Puro vector (Addgene #86708) was linearized through BsmBI digestion. sgRNAs were synthesized as 74-nt single-stranded oligonucleotides featuring 18 and 35 bp of homology to the hU6 promoter and sgRNA scaffold, respectively, and were seamlessly assembled into the vector via Gibson assembly. .. The sgRNA expression library was constructed using the LentiCRISPR v2 plasmid (Addgene #52961), following previously established cloning strategies.

Sequencing:

Amplification:

FACS:

Construct:

Expressing:

Synthesized:

Image Search Results

a , Overview of gRNA assignment for CRISPRi screen. b , Coverage for each gRNA in CRISPRi screen. Data points represent means ± SEM. n = individual gRNAs from 1 SDR-seq experiment. c , Relative distance of gRNA binding site to transcription start site (TSS). Positive values are after TSS (within transcript), negative values before transcript. Size indicates P -value calculated using MAST with Benjamini-Hochberg correction for multiple testing. Significant hits ( P -value < 0.05) are colored. d , Outline of testing for PE iPSCs. Editing can be measured by repairing a non-functional EGFP that was integrated via a lentivirus. e , Flow cytometry indicating editing in PE iPSCs.

Journal: Nature Methods

Article Title: Functional phenotyping of genomic variants using joint multiomic single-cell DNA–RNA sequencing

doi: 10.1038/s41592-025-02805-0

Figure Lengend Snippet: a , Overview of gRNA assignment for CRISPRi screen. b , Coverage for each gRNA in CRISPRi screen. Data points represent means ± SEM. n = individual gRNAs from 1 SDR-seq experiment. c , Relative distance of gRNA binding site to transcription start site (TSS). Positive values are after TSS (within transcript), negative values before transcript. Size indicates P -value calculated using MAST with Benjamini-Hochberg correction for multiple testing. Significant hits ( P -value < 0.05) are colored. d , Outline of testing for PE iPSCs. Editing can be measured by repairing a non-functional EGFP that was integrated via a lentivirus. e , Flow cytometry indicating editing in PE iPSCs.

Article Snippet: The gRNA screening vector was a modified CROP-seq vector (Addgene, 86708) to also express eGFP and include a distinct gRNA CS in the scaffold of the gRNA .

Techniques: Binding Assay, Functional Assay, Flow Cytometry

A) OPS experimental workflow. A lentiviral library containing sgRNAs of interest was transduced into target spCas9-expressing cells at a low multiplicity of infection (MOI), followed by selection for a resistance marker to generate a heterogenous pooled cell library. Cells with an integrated lentiviral vector were then fixed and permeabilized. Subsequently, the mRNA containing the sgRNA sequence was retrotranscribed in situ using an LNA-modified oligo. Next, a padlock probe was hybridized around the sgRNA sequence of the cDNA followed by probe extension and ligation. The circularized probe containing the sgRNA sequence was used as a template to perform rolling circle amplification (RCA) and the resulting amplification product is sequenced using sequencing-by-synthesis (SBS) chemistry, a form of in situ sequencing (ISS). B) Representative images of 3 ISS cycles using 4-color SBS chemistry. Scale bar: 20 microns. C) Boxplots showing the number of RCA spots per cell detected in three different cell lines expressing 5 sgRNAs at a time and using conventional OPS protocol. The middle line represents the 50 th percentile. The edges of the box represent the 25 th and 75 th percentile, respectively. The whiskers extend to 1.5 * Inter Quantile Range (IQR). D) Plot showing the inverse relationship between the length of the sgRNA read and genotyping accuracy when using ISS. E) Graph illustrating the direct relationship between spot quality threshold and genotyping accuracy when using ISS. F) Bar plot showing the percentage of lamin A-positive cells when hTERT-RPE-Cas9 cells are transduced with just a control non-targeting sgRNA (sgCTL) or an equimolar mix of 3 LMNA -targeting and 2 scrambled/non-targeting sgRNAs (sgLMNA). Mean± SD. G) Example images of hTERT-RPE-Cas9-sgLMNA cells stained with an anti-lamin A primary antibody and a Alexa488-conjugated secondary antibody together with a segmentation and sgRNA classification mask. Scale bar, 20 microns. H) Density plot showing the distribution of lamin A mean intensity values across hTERT-RPE-Cas9-sgLMNA cells. The proportion of cells with lower lamin A intensity values is larger in cells expressing LMNA -targeting sgRNAs in comparison to cells expressing non-targeting sgRNAs.

Journal: bioRxiv

Article Title: Optical Pooled Screening for the Discovery of Regulators of the Alternative Lengthening of Telomeres Pathway

doi: 10.1101/2025.02.15.638448

Figure Lengend Snippet: A) OPS experimental workflow. A lentiviral library containing sgRNAs of interest was transduced into target spCas9-expressing cells at a low multiplicity of infection (MOI), followed by selection for a resistance marker to generate a heterogenous pooled cell library. Cells with an integrated lentiviral vector were then fixed and permeabilized. Subsequently, the mRNA containing the sgRNA sequence was retrotranscribed in situ using an LNA-modified oligo. Next, a padlock probe was hybridized around the sgRNA sequence of the cDNA followed by probe extension and ligation. The circularized probe containing the sgRNA sequence was used as a template to perform rolling circle amplification (RCA) and the resulting amplification product is sequenced using sequencing-by-synthesis (SBS) chemistry, a form of in situ sequencing (ISS). B) Representative images of 3 ISS cycles using 4-color SBS chemistry. Scale bar: 20 microns. C) Boxplots showing the number of RCA spots per cell detected in three different cell lines expressing 5 sgRNAs at a time and using conventional OPS protocol. The middle line represents the 50 th percentile. The edges of the box represent the 25 th and 75 th percentile, respectively. The whiskers extend to 1.5 * Inter Quantile Range (IQR). D) Plot showing the inverse relationship between the length of the sgRNA read and genotyping accuracy when using ISS. E) Graph illustrating the direct relationship between spot quality threshold and genotyping accuracy when using ISS. F) Bar plot showing the percentage of lamin A-positive cells when hTERT-RPE-Cas9 cells are transduced with just a control non-targeting sgRNA (sgCTL) or an equimolar mix of 3 LMNA -targeting and 2 scrambled/non-targeting sgRNAs (sgLMNA). Mean± SD. G) Example images of hTERT-RPE-Cas9-sgLMNA cells stained with an anti-lamin A primary antibody and a Alexa488-conjugated secondary antibody together with a segmentation and sgRNA classification mask. Scale bar, 20 microns. H) Density plot showing the distribution of lamin A mean intensity values across hTERT-RPE-Cas9-sgLMNA cells. The proportion of cells with lower lamin A intensity values is larger in cells expressing LMNA -targeting sgRNAs in comparison to cells expressing non-targeting sgRNAs.

Article Snippet: Either the CRISPick [ ] or sgRNA Scorer [ ] web-based software was used to design sgRNA CRISPR knock-out (KO) sequences targeting genes of interest as well as non-targeting controls. sgRNA sequences were individually synthesized (IDT) and independently cloned into lentiviral sgRNA expression vectors, either CROPseq-Guide-Puro (Addgene #86708) or CROPseq-puro-v2 (Addgene #127458), using NEBuilder HiFi DNA Assembly (NEB #E5520S) and BsmBI (NEB #0739S) restriction sites.

Techniques: Expressing, Infection, Selection, Marker, Plasmid Preparation, Sequencing, In Situ, Modification, Ligation, Amplification, Transduction, Control, Staining, Comparison

A) OPS experimental workflow illustrating the steps in the ISS library preparation where the nFISH protocol can be integrated. B) Example nFISH and ISS images when both protocols are performed individually in U2OS-Cas9-sgScramble cells. ISS/RCA spot images are obtained after hybridizing a fluorescent probe against a constant region of the sgRNA-padlock probe construct previously amplified by RCA. Scale bar: 20 microns. C) Representative nFISH and ISS images when the phenotyping protocol is performed after retrotranscription (RT) and post-fixation (Option i) in U2OS-Cas9-sgScramble cells. (Top panel) nFISH images when a PNA-TelG probe is used. (Middle panel) nFISH images when RT primer is removed from reaction. (Bottom panel) ISS images showing the lack of RCA spots when ISS and nFISH are combined using Option i. Scale bar: 20 microns. D) Representative nFISH and ISS images when the phenotyping protocol is performed after RCA reaction (Option ii) and using different telomeric probes in U2OS-Cas9 cells transduced with sgCTL. (Top panel) nFISH images when the PNA-TelG probe is used. (Middle panels) nFISH images when oligo ssDNA TelG or oligo ssDNA TelC are used. (Bottom panel) Example RCA spot images regardless of telomeric probe used for nFISH. Scale bar: 20 microns. E) Bar plot of the difference in mean RCA spots per cell between ISS protocol performed individually or in combination with nFISH using Option ii. Mean± SD. F) Plot showing the difference in telomeric integrated fluorescence intensity between 24 h and 48 h of oligo ssDNA TelC probe hybridization. Mean± SD. G) Bar plot illustrating how increasing the oligo ssDNA TelC probe concentration results in a steady increase in telomeric integrated fluorescence intensity. Mean± SD. H) Example nFISH images showing the increase in telomeric signal after U2OS-Cas9-sgScamble cells are treated with 10 mM of a TLK inhibitor (TLKi) for 6 h. Scale bar: 20 microns. I) Quantification of telomeric integrated fluorescence intensity for non-treated and TLKi-treated U2OS-Cas9-sgScramble cells. Mean± SD.

Journal: bioRxiv

Article Title: Optical Pooled Screening for the Discovery of Regulators of the Alternative Lengthening of Telomeres Pathway

doi: 10.1101/2025.02.15.638448

Figure Lengend Snippet: A) OPS experimental workflow illustrating the steps in the ISS library preparation where the nFISH protocol can be integrated. B) Example nFISH and ISS images when both protocols are performed individually in U2OS-Cas9-sgScramble cells. ISS/RCA spot images are obtained after hybridizing a fluorescent probe against a constant region of the sgRNA-padlock probe construct previously amplified by RCA. Scale bar: 20 microns. C) Representative nFISH and ISS images when the phenotyping protocol is performed after retrotranscription (RT) and post-fixation (Option i) in U2OS-Cas9-sgScramble cells. (Top panel) nFISH images when a PNA-TelG probe is used. (Middle panel) nFISH images when RT primer is removed from reaction. (Bottom panel) ISS images showing the lack of RCA spots when ISS and nFISH are combined using Option i. Scale bar: 20 microns. D) Representative nFISH and ISS images when the phenotyping protocol is performed after RCA reaction (Option ii) and using different telomeric probes in U2OS-Cas9 cells transduced with sgCTL. (Top panel) nFISH images when the PNA-TelG probe is used. (Middle panels) nFISH images when oligo ssDNA TelG or oligo ssDNA TelC are used. (Bottom panel) Example RCA spot images regardless of telomeric probe used for nFISH. Scale bar: 20 microns. E) Bar plot of the difference in mean RCA spots per cell between ISS protocol performed individually or in combination with nFISH using Option ii. Mean± SD. F) Plot showing the difference in telomeric integrated fluorescence intensity between 24 h and 48 h of oligo ssDNA TelC probe hybridization. Mean± SD. G) Bar plot illustrating how increasing the oligo ssDNA TelC probe concentration results in a steady increase in telomeric integrated fluorescence intensity. Mean± SD. H) Example nFISH images showing the increase in telomeric signal after U2OS-Cas9-sgScamble cells are treated with 10 mM of a TLK inhibitor (TLKi) for 6 h. Scale bar: 20 microns. I) Quantification of telomeric integrated fluorescence intensity for non-treated and TLKi-treated U2OS-Cas9-sgScramble cells. Mean± SD.

Techniques: Construct, Amplification, Transduction, Fluorescence, Hybridization, Concentration Assay

A) Quantification of the telomeric integrated fluorescence intensity for U2OS-Cas9 cells transduced with either lentiviral sgCTL alone or with an equimolar mix of 4 lentiviral FANCM -targeting and 2 different scrambled/non-targeting sgRNAs (sgFANCM). Mean± SD . B) Illustration of the lentiviral vector used to evaluate CRISPR efficiency, pXPR-011. This vector expresses the gene EGFP and an EGFP-targeting sgRNA. C) Representative images of uninduced (Dox-) and induced (Dox+) U2OS-iCas9 cells transduced with pXPR-011. Scale bar: 20 microns. D) Bar plot showing the decrease in total EGFP intensity in induced (Dox+) U2OS-iCas9-pXPR-011 cells compared to uninduced (Dox-) cells. E) Graph showing a decrease in the percentage of EGFP-positive U2OS-iCas9-pXPR-011 cells when Cas9 expression is induced with doxycycline compared to uninduced cells. Mean± SD. F) Example nFISH images of uninduced (Dox-) and induced (Dox+) U2OS-iCas9 cells transduced with sgFANCM. Scale bar: 20 microns. G) Plot illustrating the increase in telomeric integrated fluorescence intensity for induced (Dox+) U2OS-iCas9-sgFANCM cells compared to uninduced (Dox-) cells. Mean± SD.

Journal: bioRxiv

Article Title: Optical Pooled Screening for the Discovery of Regulators of the Alternative Lengthening of Telomeres Pathway

doi: 10.1101/2025.02.15.638448

Figure Lengend Snippet: A) Quantification of the telomeric integrated fluorescence intensity for U2OS-Cas9 cells transduced with either lentiviral sgCTL alone or with an equimolar mix of 4 lentiviral FANCM -targeting and 2 different scrambled/non-targeting sgRNAs (sgFANCM). Mean± SD . B) Illustration of the lentiviral vector used to evaluate CRISPR efficiency, pXPR-011. This vector expresses the gene EGFP and an EGFP-targeting sgRNA. C) Representative images of uninduced (Dox-) and induced (Dox+) U2OS-iCas9 cells transduced with pXPR-011. Scale bar: 20 microns. D) Bar plot showing the decrease in total EGFP intensity in induced (Dox+) U2OS-iCas9-pXPR-011 cells compared to uninduced (Dox-) cells. E) Graph showing a decrease in the percentage of EGFP-positive U2OS-iCas9-pXPR-011 cells when Cas9 expression is induced with doxycycline compared to uninduced cells. Mean± SD. F) Example nFISH images of uninduced (Dox-) and induced (Dox+) U2OS-iCas9 cells transduced with sgFANCM. Scale bar: 20 microns. G) Plot illustrating the increase in telomeric integrated fluorescence intensity for induced (Dox+) U2OS-iCas9-sgFANCM cells compared to uninduced (Dox-) cells. Mean± SD.

Techniques: Fluorescence, Transduction, Plasmid Preparation, CRISPR, Expressing

A) OPS-nFISH experimental workflow. spCas9 expression was induced in the pooled cell library by treating the cells with 0.05 μg/mL doxycycline for 72h followed by seeding the cells in a 6-well plate using doxycycline-free media. After 48h, cells were fixed and processed for OPS library preparation. Then, telomeric nFISH was performed using the modified oligo ssDNA protocol, followed by SBS reactions to read the sgRNAs expressed in each cell. B) Plot showing the number of sgRNA barcode reads per cell detected during ISS in the pooled cell library. C) Bar plot showing the number of cells expressing each sgRNA in the library. D) Single-cell quantification of telomeric integrated fluorescence intensity associated to each sgRNA. E) Empirical Cumulative Distribution Function (ECDF) plot showing the cumulative distribution of telomeric integrated fluorescence intensity based on the different sgRNAs present in the library.

Journal: bioRxiv

Article Title: Optical Pooled Screening for the Discovery of Regulators of the Alternative Lengthening of Telomeres Pathway

doi: 10.1101/2025.02.15.638448

Figure Lengend Snippet: A) OPS-nFISH experimental workflow. spCas9 expression was induced in the pooled cell library by treating the cells with 0.05 μg/mL doxycycline for 72h followed by seeding the cells in a 6-well plate using doxycycline-free media. After 48h, cells were fixed and processed for OPS library preparation. Then, telomeric nFISH was performed using the modified oligo ssDNA protocol, followed by SBS reactions to read the sgRNAs expressed in each cell. B) Plot showing the number of sgRNA barcode reads per cell detected during ISS in the pooled cell library. C) Bar plot showing the number of cells expressing each sgRNA in the library. D) Single-cell quantification of telomeric integrated fluorescence intensity associated to each sgRNA. E) Empirical Cumulative Distribution Function (ECDF) plot showing the cumulative distribution of telomeric integrated fluorescence intensity based on the different sgRNAs present in the library.

Techniques: Expressing, Modification, Fluorescence

Review

cropseq guide puro vector (Addgene inc)

Structured Review

Images

Related Articles

Clone Assay:

Plasmid Preparation:

Sequencing:

Amplification:

FACS:

Construct:

Expressing:

Synthesized:

Similar Products

Image Search Results